Gene name |
SPAC3G6.13c |
Gene ID |
01/A03 |
Gene synonyms/obsolete |
rpl4101; rpl41-1 |
Gene product |
60S ribosomal protein
L41 |
Entry clone |
Cloned |
ORF length (unspliced) |
130 |
ORF length (spliced) |
78 |
Entry clone length |
130 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3G6.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTGATAAGTGGAGGAA |
Rev primer name |
SPAC3G6.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTACTAATTCAAAGTTAG |
Amino acid length |
25 |
Molecular weight |
3.4 |
Isoelectric point (calc.) |
13.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
10/12/5/14/13 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol (intranuclear microtubule
bundle?) |
Microscope used for
observation |
Zeiss |