Gene name |
SPCC663.04 |
Gene ID |
01/A05 |
Gene synonyms/obsolete |
rpl39 |
Gene product |
60S ribosomal protein
L39 |
Entry clone |
Cloned |
ORF length (unspliced) |
156 |
ORF length (spliced) |
|
Entry clone length |
156 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
12C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC663.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCTCACAAGAGTTT |
Rev primer name |
SPCC663.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGATGTTCAACTTGGTACGT |
Amino acid length |
51 |
Molecular weight |
6.3 |
Isoelectric point (calc.) |
13 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Zeiss |