Gene name |
SPCC1223.05c |
Gene ID |
01/H11 |
Gene synonyms/obsolete |
rpl3702; rpl37-2;
rpl37 |
Gene product |
60S ribosomal protein
L37 |
Entry clone |
Cloned# |
ORF length (unspliced) |
336 |
ORF length (spliced) |
276 |
Entry clone length |
336 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
9G:T |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1223.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAAGGGTACTCAATC |
Rev primer name |
SPCC1223.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGAGGCAGCAACAGCG |
Amino acid length |
91 |
Molecular weight |
10 |
Isoelectric point (calc.) |
12 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol>nucleus |
Microscope used for
observation |
DeltaVision |