| Gene name |
SPAPJ695.01c |
| Gene ID |
02/C06 |
| Gene synonyms/obsolete |
SPAP695.01c |
| Gene product |
33896 domain; possibly
Sp specific; telomeric duplication |
| Entry clone |
Cloned |
| ORF length (unspliced) |
354 |
| ORF length (spliced) |
|
| Entry clone length |
354 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
(347~352)CCAAAT:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP695.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTATTGCTTTTATACAT |
| Rev primer name |
SPAP695.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGGGATCCAAGTCGCTG |
| Amino acid length |
117 |
| Molecular weight |
13.2 |
| Isoelectric point (calc.) |
3.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLYICCLFL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |