| Gene name |
SPAC5D6.08c |
| Gene ID |
02/G08 |
| Gene synonyms/obsolete |
mes1 |
| Gene product |
meiosis II protein;
displays meiosis specific splicing; no apparent orthologs;
undergoes meiosis-dependent mRNA splicing; 5' terminal region
mRNA is crucial for its meiosis-specific splicing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
381 |
| ORF length (spliced) |
306 |
| Entry clone length |
381 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC5D6.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAAACACCGACAACAA |
| Rev primer name |
SPAC5D6.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGCATTGAAAGCAATGGA |
| Amino acid length |
101 |
| Molecular weight |
11.3 |
| Isoelectric point (calc.) |
10.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |