Gene name |
SPCP31B10.03c |
Gene ID |
03/D03 |
Gene synonyms/obsolete |
sep10 |
Gene product |
general
transcriptional regulator; RNA polymerase II accessory
protein; mutant defective in cell separation; mutant defective
in sexual differentiation; synthetic lethal with sep11 |
Entry clone |
Cloned |
ORF length (unspliced) |
420 |
ORF length (spliced) |
|
Entry clone length |
420 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
277T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCP31B10.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACAAAATGGTTACT |
Rev primer name |
SPCP31B10.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCATTTTCCTTTTTCACG |
Amino acid length |
139 |
Molecular weight |
16.8 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |