| Gene name |
SPAC6F6.05 |
| Gene ID |
03/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
oligosaccharyltransferase (epsilon subunit);
defender against cell death homolog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
422 |
| ORF length (spliced) |
369 |
| Entry clone length |
422 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F6.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCCAAAAGTGGATT |
| Rev primer name |
SPAC6F6.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCTAGGAAATTGACAGCA |
| Amino acid length |
122 |
| Molecular weight |
13.3 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEFCFSSLVL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |