| Gene name |
SPCC24B10.13 |
| Gene ID |
03/D12 |
| Gene synonyms/obsolete |
skb5 |
| Gene product |
interacts physically
with Shk1p; activator of PAK Shk1; src (SH3) homology
domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
423 |
| ORF length (spliced) |
|
| Entry clone length |
423 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
403T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC24B10.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGAAGAGACTGAAGA |
| Rev primer name |
SPCC24B10.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACCTCTAATTTAACAAAC |
| Amino acid length |
140 |
| Molecular weight |
15.8 |
| Isoelectric point (calc.) |
3.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |