Gene name |
SPCC1682.01 |
Gene ID |
03/H07 |
Gene synonyms/obsolete |
qcr9 |
Gene product |
ubiquinol cytochrome c
reductase complex subunit (cytochrome bc1 complex);
respiratory complex III |
Entry clone |
Cloned |
ORF length (unspliced) |
448 |
ORF length (spliced) |
258 |
Entry clone length |
448 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1682.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTATTCGCTCAGTTTTC |
Rev primer name |
SPCC1682.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCATCATCCTCAGCATCT |
Amino acid length |
85 |
Molecular weight |
9.7 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
aggregates |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |