| Gene name |
SPAC16A10.02 |
| Gene ID |
04/B05 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
activator p15(PC4); has a bipartite structure composed of an
amino-terminal regulatory domain and a carboxyl; terminal
cryptic DNA-binding domain (Pfam); regulated by protein
kinases (Pfam); involved in transcription initiation; involved
in the release of TFIIB; binds to TFIIB (SWISSPROT) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
461 |
| ORF length (spliced) |
411 |
| Entry clone length |
461 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
333G:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC16A10.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGGAAAACGAGTGAT |
| Rev primer name |
SPAC16A10.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTCAACCGAAGAGTCG |
| Amino acid length |
136 |
| Molecular weight |
15.4 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIHEVDDSLGL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |