| Gene name |
SPAC21E11.03c |
| Gene ID |
05/A11 |
| Gene synonyms/obsolete |
mts2; pcr1 |
| Gene product |
bZIP (basic leucine
zipper) transcription factor family; no apparent Sc ortholog;
involved in the regulation of gene expression for sexual
development; overexpression suppresses calcium activity of
ATF1; involved in stress response; activator of meiotic
recombination hotspot; similar to Sp atf21 and atf1
(paralogs); involved in meiosis |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
516 |
| ORF length (spliced) |
|
| Entry clone length |
516 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC21E11.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGCCAAAAAAAAAGA |
| Rev primer name |
SPAC21E11.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATGGGCCCACCAAGGGAT |
| Amino acid length |
171 |
| Molecular weight |
19.3 |
| Isoelectric point (calc.) |
10.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
11 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
spindle microtubules;
nuclear dots; nucleus |
| Comments for localization |
nuclear dots and
spindle by over expression |
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
DeltaVision |