Gene name |
SPAC31G5.07 |
Gene ID |
05/D07 |
Gene synonyms/obsolete |
|
Gene product |
involved in
conjugation |
Entry clone |
Cloned |
ORF length (unspliced) |
537 |
ORF length (spliced) |
|
Entry clone length |
537 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
458G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC31G5.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTGTACTTTCTGCTAA |
Rev primer name |
SPAC31G5.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACTTTGTTGTTGAGGAT |
Amino acid length |
178 |
Molecular weight |
19.3 |
Isoelectric point (calc.) |
10.7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMGVVSSLPL |
Localization (YFP) |
ER |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |