| Gene name |
SPBC215.06c |
| Gene ID |
05/D09 |
| Gene synonyms/obsolete |
|
| Gene product |
zinc finger protein;
zf-C2H2 type; similar to M. musculus LYAR cell growth
regulating nucleolar protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
537 |
| ORF length (spliced) |
|
| Entry clone length |
537 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
500C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC215.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAACCAAATTAGTTTG |
| Rev primer name |
SPBC215.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGGTAATGGGTTTAACC |
| Amino acid length |
178 |
| Molecular weight |
20.3 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
109 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |