Gene name |
SPBC9B6.05c |
Gene ID |
05/E12 |
Gene synonyms/obsolete |
lsm3 |
Gene product |
U6 snRNA-associated
protein; involved in mRNA splicing |
Entry clone |
Cloned |
ORF length (unspliced) |
548 |
ORF length (spliced) |
282 |
Entry clone length |
548 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
402T:C / 444T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC9B6.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCGGCACAGGCAGT |
Rev primer name |
SPBC9B6.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTACGAGGTGGAGCAATC |
Amino acid length |
93 |
Molecular weight |
10.6 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus; one nuclear
dot |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |