| Gene name |
SPAC926.03 |
| Gene ID |
05/F10 |
| Gene synonyms/obsolete |
rlc1 |
| Gene product |
myosin regulatory
light chain (type II); interacts physically with Myo2p;
interacts physically with Myo3p; EF hand motifs; calcium
binding protein; non-essential; involved in cytokinesis;
involved in myosin regulation; involved in contractile ring
assembly; non-essential; deletion mutant results in cell
cleavage defects; deletion mutant results in aberrant F-actin
rings; relieves auto-inhibition of myosin heavy chain
function |
| Entry clone |
Cloned |
| ORF length (unspliced) |
555 |
| ORF length (spliced) |
|
| Entry clone length |
555 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC926.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCTCTTCGAAGGAAAA |
| Rev primer name |
SPAC926.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTGCTATCTTTTGACCCA |
| Amino acid length |
184 |
| Molecular weight |
19.9 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |