Gene name |
SPBC24C6.11 |
Gene ID |
05/G03 |
Gene synonyms/obsolete |
cwf14 |
Gene product |
G10 protein; complexed
with Cdc5p; involved in mRNA splicing (implicated); involved
in cell cycle regulation (implicated) |
Entry clone |
Cloned |
ORF length (unspliced) |
555 |
ORF length (spliced) |
441 |
Entry clone length |
555 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
472T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC24C6.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCGTCTTCGAACGTC |
Rev primer name |
SPBC24C6.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCACAGCTTGCACAACCA |
Amino acid length |
146 |
Molecular weight |
17 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |