| Gene name |
SPCC5E4.08 |
| Gene ID |
05/G05 |
| Gene synonyms/obsolete |
SPCC16C4.19 |
| Gene product |
RNA-binding protein;
RNase MRP |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
555 |
| ORF length (spliced) |
|
| Entry clone length |
555 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC5E4.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCAAGAACGTAAACT |
| Rev primer name |
SPCC5E4.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATATCGGTGACATAAAGTCT |
| Amino acid length |
184 |
| Molecular weight |
20.7 |
| Isoelectric point (calc.) |
10.6 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
160 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |