| Gene name |
SPAC17H9.07 |
| Gene ID |
05/G08 |
| Gene synonyms/obsolete |
|
| Gene product |
protein signal
sequence binding activity; involved in intracellular protein
transport; involved in protein-ER targeting; involved in
SRP-dependent cotranslational membrane targeting |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
557 |
| ORF length (spliced) |
363 |
| Entry clone length |
557 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC17H9.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTTACCTGCAAACTGT |
| Rev primer name |
SPAC17H9.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCTTCTTCCCCCTTTTT |
| Amino acid length |
120 |
| Molecular weight |
13.4 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
111 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle
(nucleolus>nucleus>cytosol) |
| Microscope used for
observation |
DeltaVision |