| Gene name |
SPAC1805.08 |
| Gene ID |
05/H04 |
| Gene synonyms/obsolete |
dlc1 |
| Gene product |
dynein light chain;
involved in nuclear migration (sensu Fungi) (required);
involved in recombination (meiotic prophase) (required);
Tctex-1 family; non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
445 |
| ORF length (spliced) |
336 |
| Entry clone length |
445 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
416G:C |
| Comments |
ORF prediction was
changed. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1805.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTGTGTAAGTCGTCA |
| Rev primer name |
SPAC1805.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATGGAGATCCACATAATG |
| Amino acid length |
111 |
| Molecular weight |
12.2 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB;
nucleus>=cytosol; slightly, on spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |