Gene name |
SPAC17G8.09 |
Gene ID |
06/A10 |
Gene synonyms/obsolete |
|
Gene product |
SET1 complex; involved
in transcriptional silencing; involved in regulation of
chromatin remodelling; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
571 |
ORF length (spliced) |
387 |
Entry clone length |
571 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17G8.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAGGGATGTAACACT |
Rev primer name |
SPAC17G8.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTGCGCCCATCCATGGTT |
Amino acid length |
128 |
Molecular weight |
14.9 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|