Gene name |
SPAC22F3.11c |
Gene ID |
06/A12 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan |
Entry clone |
Cloned#/Sequence
mismatch |
ORF length (unspliced) |
573 |
ORF length (spliced) |
456 |
Entry clone length |
573 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
124C:deletion |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC22F3.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACAGATATAATCCCCC |
Rev primer name |
SPAC22F3.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAATTAGTTGAGCCAAAG |
Amino acid length |
151 |
Molecular weight |
17.9 |
Isoelectric point (calc.) |
10.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
112/111 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB;
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |