| Gene name |
SPCC576.07 |
| Gene ID |
06/B03 |
| Gene synonyms/obsolete |
ret3 |
| Gene product |
coatomer zeta subunit;
the adaptor complexes small subunit family; the coatomer is a
cytosolic protein complex that binds to dilysine motifs and
reversibly associates with Golgi non- clathrin-coated
vesicles, which further mediate biosynthetic protein transport
from the ER, via the Golgi up to the trans Golgi network;
coatomer complex is required for budding from Golgi membranes,
and is essential for the retrograde Golgi-to-ER transport of
dilysine-tagged proteins (By similarity); the zeta subunit may
be involved in regulating the coat assembly and, hence, the
rate of biosynthetic protein transport due to its
association-dissociation properties with the coatomer complex
(By similarity). |
| Entry clone |
Cloned |
| ORF length (unspliced) |
573 |
| ORF length (spliced) |
|
| Entry clone length |
573 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC576.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATTTGACTCTATACGC |
| Rev primer name |
SPCC576.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATGTTCCTTTCAAAATT |
| Amino acid length |
190 |
| Molecular weight |
21.6 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYAVNAFLIL/LRSIRDALEL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|