Gene name |
SPAPYUG7.06 |
Gene ID |
06/B10 |
Gene synonyms/obsolete |
|
Gene product |
DUF862; conserved
eukaryotic protein; human homolog PNAS-4 is acute
promyelocytic leukemia cell line NB4's apoptosis-related gene;
no apparent Sc ortholog |
Entry clone |
Cloned# |
ORF length (unspliced) |
606 |
ORF length (spliced) |
|
Entry clone length |
606 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
ORF prediction was
changed (extended). 06/B09 was cloned at first. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAPYUG7.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGTATACATTAATGT |
Rev primer name |
SPAPYUG7.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGAAGTGAATCAGTGATG |
Amino acid length |
201 |
Molecular weight |
21.9 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |