Gene name |
SPAC3A12.14 |
Gene ID |
06/C03 |
Gene synonyms/obsolete |
cam1 |
Gene product |
calmodulin; EF hand
motifs; calcium binding protein; essential; involved in
chromosome segregation (required) |
Entry clone |
Cloned# |
ORF length (unspliced) |
579 |
ORF length (spliced) |
453 |
Entry clone length |
579 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
Spliced just
downstream of ATG. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC3A12.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTATGTTTATTATATTG |
Rev primer name |
SPAC3A12.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTGGAAGAAATGACACGA |
Amino acid length |
150 |
Molecular weight |
16.9 |
Isoelectric point (calc.) |
3.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |