| Gene name |
SPBC146.04 |
| Gene ID |
06/C05 |
| Gene synonyms/obsolete |
|
| Gene product |
Erv1/Alr family;
involved in mitochondrial biogenesis; similar to Sp
SPAC3G6.08 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
579 |
| ORF length (spliced) |
|
| Entry clone length |
579 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
151A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC146.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCCTTAATAGAAGAAT |
| Rev primer name |
SPBC146.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAGAATAGTCGTGATCT |
| Amino acid length |
192 |
| Molecular weight |
22.3 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|