| Gene name |
SPCC306.02c |
| Gene ID |
06/C08 |
| Gene synonyms/obsolete |
|
| Gene product |
Rab GTPase binding;
involved in vesicle-mediated transport (predicted) (S.
cerevisiae 2-hybrid data) |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
580 |
| ORF length (spliced) |
516 |
| Entry clone length |
580 |
| No. of intron |
1 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC306.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGCACTGTCGTTGAG |
| Rev primer name |
SPCC306.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTTGTTGCTCGACAGTC |
| Amino acid length |
171 |
| Molecular weight |
18.8 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAIIAMLVI/LACVLIPLGL |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|