| Gene name |
SPCC2H8.05c |
| Gene ID |
06/D01 |
| Gene synonyms/obsolete |
SPCC63.01c |
| Gene product |
hypothetical coiled
coil protein; hypothetical protein; sequence orphan; predicted
coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
585 |
| ORF length (spliced) |
|
| Entry clone length |
585 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
24G:A / 307T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC2H8.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCCTGATGATGTCTC |
| Rev primer name |
SPCC2H8.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGCTTATATGATCTGAT |
| Amino acid length |
217 |
| Molecular weight |
24.6 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |