Gene name |
SPAC1296.04 |
Gene ID |
06/G02 |
Gene synonyms/obsolete |
|
Gene product |
very hypothetical
protein; dysferlin-C terminal domain |
Entry clone |
Cloned |
ORF length (unspliced) |
1142 |
ORF length (spliced) |
747 |
Entry clone length |
1142 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
ORF prediction was
changed. |
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1296.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGGAATCTGAAAGGAC |
Rev primer name |
SPAC1296.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCTGGGGAGTTGGAGAT |
Amino acid length |
248 |
Molecular weight |
28.5 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
38/32 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery |
Comments for localization |
a few cytoplasmic
dots |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |