| Gene name |
SPAC3C7.14c |
| Gene ID |
06/G10 |
| Gene synonyms/obsolete |
obr1 |
| Gene product |
flavodoxin; involved
in brefeldin A resistance; does NOT mediate brefeldin
resistance; involved in mating-type silencing; elevated in
rhp6-1/sng1-1; mediator of Rhp6 in mating type silencing
multiply ubiquitination by Rhp6 in vivo; interacts with mat2
locus during S phase; possibly involved in propagation of
repressed chromatin structure of the switching donor
loci |
| Entry clone |
Cloned |
| ORF length (unspliced) |
609 |
| ORF length (spliced) |
|
| Entry clone length |
609 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3C7.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACCGCAAACACCGT |
| Rev primer name |
SPAC3C7.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGCGGAAAACAGTCTTG |
| Amino acid length |
202 |
| Molecular weight |
21.8 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|