Gene name |
SPBC887.06c |
Gene ID |
06/H08 |
Gene synonyms/obsolete |
grd19 |
Gene product |
sorting nexin;
phosphoinositide binding; PX domain; involved in intracellular
protein transport; involved in retrograde transport |
Entry clone |
Cloned |
ORF length (unspliced) |
616 |
ORF length (spliced) |
432 |
Entry clone length |
616 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC887.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATAAATTAAGTAGACC |
Rev primer name |
SPBC887.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGCGTAGGCTTGAATTCC |
Amino acid length |
143 |
Molecular weight |
16.9 |
Isoelectric point (calc.) |
9.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
a few cytoplasmic dots
by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |