| Gene name |
SPAC227.02c |
| Gene ID |
06/H10 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic conserved
protein; Sc YPR143W is null lethal; predicted coiled-coil
region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
618 |
| ORF length (spliced) |
|
| Entry clone length |
618 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
356A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC227.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGAAATCACAAAGATC |
| Rev primer name |
SPAC227.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGGGATTTTATGAGGTCA |
| Amino acid length |
205 |
| Molecular weight |
23.4 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
116/116 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nucleolus |
| Comments for localization |
one bright nuclear dot
by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |