| Gene name |
SPBC16C6.05 |
| Gene ID |
07/B04 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; conserved protein; similar to human DENR/DRP
density-regulated protein-a protein expressed at high cell
density but not during growth arrest |
| Entry clone |
Cloned |
| ORF length (unspliced) |
626 |
| ORF length (spliced) |
573 |
| Entry clone length |
626 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
19C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16C6.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTCACAAACCATCCC |
| Rev primer name |
SPBC16C6.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGCTTCTTCTTAGATTTC |
| Amino acid length |
190 |
| Molecular weight |
21.6 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
107 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |