Gene name |
SPCC4B3.02c |
Gene ID |
07/D06 |
Gene synonyms/obsolete |
|
Gene product |
Golgi transport
protein; belongs to the UPF0198 family; 4 predicted
transmembrane helices |
Entry clone |
Cloned |
ORF length (unspliced) |
646 |
ORF length (spliced) |
390 |
Entry clone length |
646 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC4B3.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGGCTATCGGATTTACA |
Rev primer name |
SPCC4B3.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACAGGACTTTGTTGGTAT |
Amino acid length |
129 |
Molecular weight |
14.7 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSLGNLLL/LFKVFYPLII |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |