| Gene name |
SPAC1952.08c |
| Gene ID |
07/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; possibly involved in RNA processing from Sc 2-hybrid
data |
| Entry clone |
Cloned |
| ORF length (unspliced) |
648 |
| ORF length (spliced) |
573 |
| Entry clone length |
648 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
(-5)C:T / 6C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1952.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCTCAAAAGTCGATTC |
| Rev primer name |
SPAC1952.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATGGAGTCTCATCTCCT |
| Amino acid length |
190 |
| Molecular weight |
21.6 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |