Gene name |
SPCC970.12 |
Gene ID |
07/E03 |
Gene synonyms/obsolete |
|
Gene product |
sequence orphan;
hypothetical protein |
Entry clone |
Cloned |
ORF length (unspliced) |
649 |
ORF length (spliced) |
468 |
Entry clone length |
649 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
603A:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC970.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCCAGACGGAAACTAG |
Rev primer name |
SPCC970.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGTTTATTTTTCTCTACT |
Amino acid length |
155 |
Molecular weight |
17.8 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWVVICYTLFL |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |