| Gene name |
SPAP8A3.06 |
| Gene ID |
07/E05 |
| Gene synonyms/obsolete |
|
| Gene product |
U2AF small subunit
(U2AF-23); involved in mRNA splicing; zinc finger protein;
zf-CCCH type (2); rrm RNA recognition motif; RNA-binding
protein; SF1-U2AF(59)-U2AF(23) complex; involved in
pre-spliceosome formation; similar to human U2AF35; no
apparent Sc ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
651 |
| ORF length (spliced) |
|
| Entry clone length |
651 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAP8A3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAGTCATTTGGCAAG |
| Rev primer name |
SPAP8A3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTGCGTTCAGCAGTT |
| Amino acid length |
216 |
| Molecular weight |
25 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |