| Gene name |
SPAC16E8.05c |
| Gene ID |
07/G05 |
| Gene synonyms/obsolete |
mde1 |
| Gene product |
likely to play a role
in meiosis or sporulation; requires Mei4p for transcriptional
activation; similar to Sp SPAC8F11.05c; possibly Sp
specific |
| Entry clone |
Cloned |
| ORF length (unspliced) |
673 |
| ORF length (spliced) |
630 |
| Entry clone length |
673 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
95T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC16E8.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCCATGCGACTCAGCT |
| Rev primer name |
SPAC16E8.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATAACAATCAGCTCATCA |
| Amino acid length |
209 |
| Molecular weight |
24.2 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLFCFLPI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Zeiss |