Gene name |
SPAC644.13c |
Gene ID |
07/G10 |
Gene synonyms/obsolete |
|
Gene product |
involved in targeting
and fusion of ER to Golgi transport vesicles; not Sc YIP1
homolog; no apparent Sc ortholog; YIP1 family; GTPase
interacting protein |
Entry clone |
Cloned |
ORF length (unspliced) |
678 |
ORF length (spliced) |
|
Entry clone length |
678 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
17A:T / 656T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC644.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGACATAGGAAAACA |
Rev primer name |
SPAC644.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAAAAGATAATCCAAGCT |
Amino acid length |
225 |
Molecular weight |
25.3 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWGPLIFSLVI/LLAVYPLFL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |