| Gene name |
SPCC70.09c |
| Gene ID |
07/H10 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved hypothetical
protein; similar to Sp SPBC19C7.04c; possibly fungal
specific |
| Entry clone |
Cloned |
| ORF length (unspliced) |
683 |
| ORF length (spliced) |
627 |
| Entry clone length |
683 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
504T:C / 631A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC70.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAAAGCAAGCAGGTGG |
| Rev primer name |
SPCC70.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTCAAAACATGATGAACC |
| Amino acid length |
208 |
| Molecular weight |
23.3 |
| Isoelectric point (calc.) |
10.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery, especially
at cell tip and site of septum formation;
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |