| Gene name |
SPAP8A3.08 |
| Gene ID |
08/A02 |
| Gene synonyms/obsolete |
cdc4 |
| Gene product |
EF hand motifs;
essential; calcium binding protein; essential; involved in
cytokinesis (required); involved in septation (required);
involved in contractile ring assembly (required); actin cap
component (putative); involved in cell polarity; myosin light
chain; interacts physically with a phosphatidylinositol
4-kinase; interacts physically with IQ-domain containing
proteins |
| Entry clone |
Cloned |
| ORF length (unspliced) |
689 |
| ORF length (spliced) |
426 |
| Entry clone length |
689 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP8A3.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGACAGACGATTCACC |
| Rev primer name |
SPAP8A3.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTGGCAAGAATCATTTGA |
| Amino acid length |
141 |
| Molecular weight |
15.6 |
| Isoelectric point (calc.) |
4.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol;
periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|