Gene name |
SPCC737.01c |
Gene ID |
08/B02 |
Gene synonyms/obsolete |
SPCC297.06c |
Gene product |
hypothetical protein;
sequence orphan; predicted coiled-coil |
Entry clone |
Cloned |
ORF length (unspliced) |
693 |
ORF length (spliced) |
|
Entry clone length |
693 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
344A:G / 381A:C /
510T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC737.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGGGGAAAATCAATTA |
Rev primer name |
SPCC737.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTAGAAAAACCTTGCAAC |
Amino acid length |
230 |
Molecular weight |
27.6 |
Isoelectric point (calc.) |
10.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
bright and large
nuclear dots by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |