Gene name |
SPAC9E9.14 |
Gene ID |
08/B04 |
Gene synonyms/obsolete |
vps24 |
Gene product |
SNF7 family; involved
in intracellular protein transport; involved in secretory
pathway; class E vps; involved in endosomal maturation |
Entry clone |
Cloned |
ORF length (unspliced) |
696 |
ORF length (spliced) |
|
Entry clone length |
696 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC9E9.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAACTGTAAGATCTTA |
Rev primer name |
SPAC9E9.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGATTTCAAAGCATCTAGC |
Amino acid length |
231 |
Molecular weight |
26.3 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNDQMAMLKI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal
|