| Gene name |
SPBP8B7.22 |
| Gene ID |
08/G05 |
| Gene synonyms/obsolete |
erd2 |
| Gene product |
ER lumen protein
retaining receptor activity; involved in intracellular protein
transport; involved in protein-ER retention; involved in ER to
golgi transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
731 |
| ORF length (spliced) |
639 |
| Entry clone length |
731 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
161C:T / 693A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.22.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACATTTTTCAGTGCACT |
| Rev primer name |
SPBP8B7.22.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGGTAATCGGAACTTT |
| Amino acid length |
212 |
| Molecular weight |
24.7 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVYVTRYLNL |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |