Gene name |
SPAC1687.17c |
Gene ID |
08/H12 |
Gene synonyms/obsolete |
|
Gene product |
Der1-like (degradation
in the ER) family; no apparent Sc ortholog;
non-essential |
Entry clone |
Cloned# |
ORF length (unspliced) |
741 |
ORF length (spliced) |
507 |
Entry clone length |
741 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC1687.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTTTGCCAGAATT |
Rev primer name |
SPAC1687.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACTGTAGAAAAATCTGTA |
Amino acid length |
168 |
Molecular weight |
19.6 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYRISILGL/LRTGIFPLLDL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |