| Gene name |
SPAC23A1.03 |
| Gene ID |
09/A10 |
| Gene synonyms/obsolete |
apt1 |
| Gene product |
adenine
phosphoribosyltransferase (APRT); similar to Sc APT1;
phosphoribosyl transferases family; involved in nucleotide
metabolism; involved in purine base metabolism |
| Entry clone |
Cloned |
| ORF length (unspliced) |
745 |
| ORF length (spliced) |
567 |
| Entry clone length |
745 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
173A:G / 616T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23A1.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGACGATAGAATCAA |
| Rev primer name |
SPAC23A1.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAAATTCACTACCATCA |
| Amino acid length |
188 |
| Molecular weight |
20.7 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGGELVGHLFL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |