| Gene name |
SPCC162.06c |
| Gene ID |
09/B04 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in
intracellular protein transport; SNF7 family; class E vps;
predicted coiled-coil |
| Entry clone |
Cloned |
| ORF length (unspliced) |
747 |
| ORF length (spliced) |
633 |
| Entry clone length |
747 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
(-7)C:deletion |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC162.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATCGTCTTTTTGGTAG |
| Rev primer name |
SPCC162.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGAGCTGTTGAAGGTTCA |
| Amino acid length |
210 |
| Molecular weight |
23.5 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
vacuole membrane |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |