| Gene name |
SPAC140.01 |
| Gene ID |
09/C12 |
| Gene synonyms/obsolete |
sdh2 |
| Gene product |
succinate
dehydrogenase (ubiquinone); iron-sulfur protein subunit;
involved in tricarboxylic acid cycle; involved in
mitochondrial electron transport, succinate to ubiquinone;
involved in succinate metabolism |
| Entry clone |
Cloned |
| ORF length (unspliced) |
759 |
| ORF length (spliced) |
|
| Entry clone length |
759 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
253A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC140.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACAGAGGCCAACAT |
| Rev primer name |
SPAC140.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGTAGCCATCAAAGCC |
| Amino acid length |
252 |
| Molecular weight |
28.5 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
a lot of moving small
dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |