| Gene name |
SPCC14G10.01 |
| Gene ID |
09/D01 |
| Gene synonyms/obsolete |
SPBC18B5.12;
SPCC18B5.12 |
| Gene product |
conserved
hypothetical; conserved protein; UPF0038 family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
759 |
| ORF length (spliced) |
711 |
| Entry clone length |
759 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
371A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC14G10.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGATTCTTGGTTTAAC |
| Rev primer name |
SPCC14G10.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATATATGTTTTCTGAATTCA |
| Amino acid length |
236 |
| Molecular weight |
26.8 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYENIHNVLPL/LLCLILPPLQI |
| Localization (YFP) |
ambiguous structure;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |