Gene name |
SPAC9E9.13 |
Gene ID |
09/D02 |
Gene synonyms/obsolete |
wos2 |
Gene product |
p23 homolog; Hsp
associated co-chaperone; interacts physically with Hsp90p;
involved in mitotic control; interacts with Wee1p; interacts
physically with Cdc2p; 3' UTR directs the formation multiple
mRNAs; alternative polyadenylation sites results in the
production of the 3 differently sized transcripts; alternative
transcripts |
Entry clone |
Cloned# |
ORF length (unspliced) |
760 |
ORF length (spliced) |
561 |
Entry clone length |
760 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC9E9.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTAAATACACAAAT |
Rev primer name |
SPAC9E9.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCTTTCTTTTCGTTACTG |
Amino acid length |
186 |
Molecular weight |
20.9 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |