Gene name |
SPBC2G5.02c |
Gene ID |
09/D12 |
Gene synonyms/obsolete |
|
Gene product |
casein kinase II (beta
subunit); similar to Sp ckb1 |
Entry clone |
Cloned |
ORF length (unspliced) |
765 |
ORF length (spliced) |
|
Entry clone length |
765 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
38C:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2G5.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCGAAAAAACCTCAT |
Rev primer name |
SPBC2G5.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCACTTTCAGACTCCGAA |
Amino acid length |
254 |
Molecular weight |
29 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFNLTGLNL |
Localization (YFP) |
nucleus>cytosol;
SPB? |
Comments for localization |
nuclear dots by over
expression; 1~2 dots/nucleus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |